aTc→IV-HSL Responder Module

Overview

The IV-HSL Responder module integrates the 🟤TetR Inducible Module and the IV-HSL Emitter Module to create this responder module, which generates the small molecule isovaleryl-l-homoserine lactone (IV-HSL) in response to anhydrotetracycline (aTc).

The module is implemented as a single genetic construct, encoding the BjaI enzyme under control of the tet operator. A second construct allows E. coli to act as a IV-HSL receiver and report the activity of the responder module.

There are three variants of the responder module. pT7-tetO-bjaI is the simplest construct, however it has poor dynamic range—leaky expression in the off state produces sufficient IV-HSL to induce receiving E. coli cells. The other two variants resolve this issue: tetO-pT7-tetO-bjaI (the “sandwich” operator) and pT7-tetO-tetO-bjaI (the “train” operator) provide tight repression in the off state and improve dynamic range (Lutz and Bujard, 1997). We use pT7-tetO-tetO-bjaI to implement the Responder Cell.

As in the IV-HSL Emitter Module, we use bjaR-GFP-native as a receiver module, expressing GFP in response to IV-HSL in E. coli cells.

Usage

The IV-HSL emitter module may be implemented by assembling the pT7-tetO-tetO-bjaI responder construct within a standard PURE reaction, following Assemble PURE Reactions. Add equimolar amounts of the substrates SAM and IV-CoA at 0.3 uM and 0.08 uM final concentration, respectively.

The responder module may also be generated as linear DNA from the IV-HSL Emitter Module pT7-bjaI construct, using the primers listed below.

DNA Parts

pT7-tetO-tetO-bjaI—🧬Nucleus v0.3.0 Distribution Plate, Untitled
bjaR-GFP-native—🧬Nucleus v0.3.0 Distribution Plate, Untitled

Protein Components

TetR purified protein—MedChemExpress HY-P71520, resuspended to 10 uM.

Cell Components

XL-10 Gold

Primers and PCR

Name	Sequence	Tm (full) (ºC)	Ta (binding) (ºC)
tetO-pT7-tetO F	gacggccagttccctatcagtgatagagagcatgagacggtctcag	72	64
pT7-tetO-tetO F	aggagtaatacgactcactatagggtccctatcagtgatagagattgacaggtccctatc	72	70
M13 Reverse	caggaaacagctatgaccatg	63	63

Name	Vector	Primer F	Primer R	Anneal (ºC)	Extension Time (s)
tetO-pT7-tetO	pT7-tetO-bjaI	tetO-pT7-tetO F	M13 R	64	25
pT7-tetO-tetO	pT7-tetO-bjaI	pT7-tetO-tetO F	M13 R	64	25

Reaction Construction

	Samples (each)	Positive controls (each)	Negative control
Component	Volume (uL)	Volume (uL)	Volume (uL)	Notes
PURE Solution A	4	4	4	PURE energy solution: small molecules
PURE Solution B	3	3	3	PURE proteins and ribosomes
RNAse Inhibitor	0.5	0.5	0.5	Prevents RNAse activity
Linear DNA (30 nM)	0.2	0.2	0	Different DNAs encoding BjaI are controlled by the Tet operator and driven by the T7 promoter.
SAM (5 mM)	0.6	0.6	0
IV-CoA (5 mM)	0.16	0.6	0
TetR (30 uM)	1.54	0	0	Repress the expression of DNA with Tet operator
Nucleus-Free Water	0	1.54	2.5
Total	10	10	10

Experimental Method

Prepare M9 media containing cells and antibiotics:

Prepare M9 Media containing 1× M9 salts, 0.34 mg/ml 1-thiamine hydrochloride, 0.2% casamino acids, 2 mM MgSO4, 100 µM CaCl2 and 0.4% (wt/vol) glucose.

Use a pipette tip to scrape some of the frozen bacteria off of the top and inoculate a 1.5 mL eppendorf containing the M9 media with 100 ug/mL carbenicillin.

Gently mix the tube by inverting 5 times. The solution in the tube will be named M9-cell solution in the following part.

Incubate samples and controls containing PURE reactions at 37c for 1.5 hrs.

Mix varying amounts of samples or controls (1 or 2 µL) with 100 µL of the M9-cell solution.

Performance Data

Induction of receiver E. coli

Note: Excessive addition of PURE reaction to the M9-cell solution negatively impacts GFP induction in E. coli, with 1 µL proving more effective than 2 µL. As a result, the figures below focus on the outcomes observed with the addition of 1 µL of samples or controls.

Repression Validation

Observations:

Positive controls (samples without any tetR) exhibited similar GFP fluorescence, indicating that all DNA constructs (pT7-tetO-tetO-BjaI, tetO-pT7-tetO-BjaI, and pT7-tetO-BjaI) are effective for BjaI expression.
Repression efficiency follows the order: pT7-tetO-tetO-BjaI > tetO-pT7-tetO-BjaI > pT7-tetO-BjaI. Based on this, pT7-tetO-tetO-BjaI was selected for use in the subsequent liposome experiment to construct the responder cells.

Resources and References

Papers

Smith, J. M., Hartmann, D. & Booth, M. J. Engineering cellular communication between light-activated synthetic cells and bacteria. Nature Chemical Biology vol. 19 1138–1146 (2023) [link]
Lindemann, A. et al. Isovaleryl-homoserine lactone, an unusual branched-chain quorum-sensing signal from the soybean symbiont Bradyrhizobium japonicum. Proceedings of the National Academy of Sciences vol. 108 16765–16770 (2011) [link]

Credits

Jefferson Smith & Michael Booth (Oxford / UCL)
b.next